BBa_K416003 1 BBa_K416003 Yeast Secretion Tag 2010-06-22T11:00:00Z 2015-05-08T01:12:27Z This part was sent to use from Dr. Sheldon Park of the University of Buffalo. This secretion tag when linked to the N-terminal of the protein directs extracellular secretion of the protein. After targeting through the ER to the golgi, this "pre-pro" tag is cleaved by the KEX-2 protease resulting in secretion of protein without the aforementioned tag. To use this tag, attached it directly upstream of your proteins CDS. false false _527_ 0 7430 9 It's complicated true There was an illegal Xbal1 site at bp 101 and we removed it through altering the primers necessary for biobricking the sequence. false John Phair BBa_K392003 1 BBa_K392003 yeast ADH1 terminator 2010-10-09T11:00:00Z 2015-05-08T01:12:20Z Registry parts BBa_K105027 (promoter) and BBa_J63003 (Kozak). Engineered 'cyc100 promoter' of <i>Saccharomyces cerevisiae</i> with Kozak sequence attached downstream. false false _528_ 0 6220 9 It's complicated true Assembled by 3A method. false Tadashi Nakamura, Shuhei Yasumoto, Takahiro Saka, Saya Kakuda BBa_K792001 1 MFa1-Kozak Kozak sequence from yeast &#945;-factor mating pheromone (MF&#945;1) 2012-09-23T11:00:00Z 2015-05-08T01:13:23Z http://www.yeastgenome.org/cgi-bin/locus.fpl?locus=MFA1 The Kozak sequence is the eukaryotic analog of the bacterial RBS, it is short sequence that includes the ATG, required for proficient initiation of translation. It is known that the 5???UTR sequence of the MF&#945;1 gene of yeast produces efficient initiation of translation. This part is that specific region of the MF&#945;1 gene. false false _1047_ 0 11811 9 Not in stock false None false Manuel Gim??nez annotation2197872 1 start range2197872 1 19 21 annotation2197870 1 BamHI restriction site range2197870 1 1 6 annotation2197871 1 rbs range2197871 1 7 21 BBa_M36085 1 BBa_M36085 Winter Flounder Antifreeze Protein Actuator With Secretion Tag 2014-04-29T11:00:00Z 2015-05-08T01:14:03Z The AFP comes from Uniprot and the parts come from the parts registry. This is our actuator to generate antifreeze protein activity in yeast. We are expressing the winter flounder AFP to be able to minimize ice growth. It includes the yeast secretion tag so that it is expressed outside of the cell and so that it will be expressed in the solution. false false _848_ 0 22183 9 Not in stock false We had to make sure that we had everything that could express the protein in yeast (Kozac sequence, Yeast secretion Tag) and optimized our sequences for yeast. false Ashley Hammerbacher Celina Malav?? component2372793 1 BBa_M36082 component2372795 1 BBa_M36084 component2372794 1 BBa_K416003 component2372796 1 BBa_K392003 component2372792 1 BBa_K792001 annotation2372793 1 BBa_M36082 range2372793 1 28 273 annotation2372792 1 BBa_K792001 range2372792 1 1 21 annotation2372794 1 BBa_K416003 range2372794 1 280 393 annotation2372796 1 BBa_K392003 range2372796 1 431 559 annotation2372795 1 BBa_M36084 range2372795 1 402 422 BBa_M36082 1 BBa_M36082 Winter Flounder Antifreeze Protein 2014-04-29T11:00:00Z 2015-05-08T01:14:02Z Uniprot The Antifreeze Protein DNA false false _848_ 0 22183 9 Not in stock false We simply got the sequence off of Uniprot so that we could create the basic part to integrate into our actuator false Ashley Hammerbacher Celina Malav?? BBa_M36084 1 BBa_M36084 Histidine Tag and Stop Codon 2014-04-29T11:00:00Z 2015-05-08T01:14:02Z We know that histidine tags are a sequence of 6 Histidines and 1 stop codon Histidine Tag and Stop Codon Sequences false false _848_ 0 22183 9 Not in stock false Histidine tag must be before stop codon false Ashley Hammerbacher Celina Malav?? BBa_M36084_sequence 1 catcatcatcatcatcattag BBa_K416003_sequence 1 atgaaagttttgattgttttgttggctattttcgctgctttgccattggctttggctcaaccagttatttctactactgttggttctgctgctgaaggttcactagataaaaga BBa_M36082_sequence 1 atggcgctgagcctgtttaccgtgggccagctgatttttctgttttggaccatgcgcattaccgaagcgagcccggatccggcggcgaaagcggcgccggcggcggcggcggcgccggcggcggcggcgccggataccgcgagcgatgcggcggcggcggcggcgctgaccgcggcgaacgcgaaagcggcggcggaactgaccgcggcgaacgcggcggcggcggcggcggcgaccgcgcgcggc BBa_M36085_sequence 1 ggatccacgattaaaagaatgtactagatggcgctgagcctgtttaccgtgggccagctgatttttctgttttggaccatgcgcattaccgaagcgagcccggatccggcggcgaaagcggcgccggcggcggcggcggcgccggcggcggcggcgccggataccgcgagcgatgcggcggcggcggcggcgctgaccgcggcgaacgcgaaagcggcggcggaactgaccgcggcgaacgcggcggcggcggcggcggcgaccgcgcgcggctactagatgaaagttttgattgttttgttggctattttcgctgctttgccattggctttggctcaaccagttatttctactactgttggttctgctgctgaaggttcactagataaaagatactagagcatcatcatcatcatcattagtactagaggcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctattactagagcccgccgccaccatggag BBa_K392003_sequence 1 gcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctattactagagcccgccgccaccatggag BBa_K792001_sequence 1 ggatccacgattaaaagaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z