BBa_M36009 1 BBa_M36009 5' Bicistronic UTR (strong), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z c/o Vivek Mutalik et al. BIOFAB Emeryville 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false please see long description. false Drew Endy BBa_M36103 1 BBa_M36103 prokaryotic HY5 protein gene sequence 2011-05-02T11:00:00Z 2015-05-08T01:14:03Z Arabidopsis This part is the HY5 eukaryotic protein modified to be expressed in prokaryotes. The DNA sequence has been translated from the amino acids to be most compatible with prokaryotic DNA transcription. false false _848_ 0 9548 9 Not in stock false Correctly translating the HY5 amino acid sequence to DNA nucleotides that would be compatible with prokaryotic machinery. false Andee Wallace, Taylor Nguyen, Chad Viergever annotation2119125 1 start codon range2119125 1 1 3 annotation2119126 1 stop codon range2119126 1 508 510 BBa_M36104 1 BBa_M36104 protein generator- promoter, UTR, HY5 gene 2011-05-02T11:00:00Z 2015-05-08T01:14:03Z 5' UTR and terminator sequence are provided by Drew Endy for the purposes of this class. The HY5 sequence is from Arabidopsis. Composite part that includes a 5' UTR upstream of the HY5 DNA sequence, and a terminator sequence. true false _848_ 0 9548 9 Discontinued false Correct ordering of parts. false Andee Wallace, Taylor Nguyen, Chad Viergever component2118887 1 BBa_M36009 component2118888 1 BBa_M36103 component2118886 1 BBa_J23100 component2118889 1 BBa_M36010 annotation2118887 1 BBa_M36009 range2118887 1 36 82 annotation2118888 1 BBa_M36103 range2118888 1 83 592 annotation2118889 1 BBa_M36010 range2118889 1 593 674 annotation2118886 1 BBa_J23100 range2118886 1 1 35 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_M36103_sequence 1 atgcaggaacaggcgaccagcagcctggcggcgagcagcctgccgagcagcagcgaacgcagcagcagcagcgcgccgcatctggaaattaaagaaggcattgaaagcgatgaagaaattcgccgcgtgccggaatttgcgggcggcgaagcggtgggcaaagaaaccagcggccgcgaaagcggcagcgcgaccggccaggaacgcacccaggcgaccgtgggcgaaagccagcgcaaacgcggccgcaccccggcggaaaaagaaaacaaacgcctgaaacgcctgctgcgcaaccgcgtgagcgcgcagcaggcgcgcgaacgcaaaaaagcgtatctgagcgaactggaaaaccgcgtgaaagatctggaaaacaaaaacagcgaactggaagaacgcctgagcaccctgcagaacgaaaaccagatgctgcgccatattctgaaaaacaccaccggcaacaaacgcggcggcggcggcggcagcaacgcggatgcgagcctgtaa BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36104_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctatagagggtattaataatgtatggattaaaaggggaggtataacaaatgcaggaacaggcgaccagcagcctggcggcgagcagcctgccgagcagcagcgaacgcagcagcagcagcgcgccgcatctggaaattaaagaaggcattgaaagcgatgaagaaattcgccgcgtgccggaatttgcgggcggcgaagcggtgggcaaagaaaccagcggccgcgaaagcggcagcgcgaccggccaggaacgcacccaggcgaccgtgggcgaaagccagcgcaaacgcggccgcaccccggcggaaaaagaaaacaaacgcctgaaacgcctgctgcgcaaccgcgtgagcgcgcagcaggcgcgcgaacgcaaaaaagcgtatctgagcgaactggaaaaccgcgtgaaagatctggaaaacaaaaacagcgaactggaagaacgcctgagcaccctgcagaacgaaaaccagatgctgcgccatattctgaaaaacaccaccggcaacaaacgcggcggcggcggcggcagcaacgcggatgcgagcctgtaatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36009_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z