BBa_M36135 1 BBa_M36135 Transcription terminator (apFAB388) 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z BIOFAB: part apFAB388, construct pFAB822 Released HQ 2013 Strong terminator from BIOFAB's terminator project false false _848_ 0 13700 9 In stock false Length similar to terminators used in Delebecque et al., Science 2011 false Vir Choksi BBa_M36128 1 BBa_M36128 d2' (RNA scaffold) 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z Delebecque et al, Science 2011. Encodes for the first part of a 2-dimensional self-assembling RNA scaffold. d2' is a sequence followed by the PP7 binding domain. The 2D RNA assembly D2 forms from d2' and d2'', each followed by a distinct PP7 and MS2 aptamer. The dormant tile d2' spontaneously generates the pro-tile d2-1, which interacts with d2'' to generate tile d2-2. d2-2 then self-assembles into the 2D RNA scaffold D2 with PP7 and MS2 binding domains. false false _848_ 0 13700 9 Not in stock false This part is only functional in the context of the other parts required for the 2D RNA scaffold. false Vir Choksi BBa_M36131 1 BBa_M36131 2D RNA scaffold 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z Delebecque et al., Science 2011 This is the sequence encoding the two-dimensional self-assembling RNA scaffold. It has binding domains for proteins MS2 and PP7. false false _848_ 0 13700 9 Not in stock false We placed d2' and the PP7 aptamer under a rhamnose inducible promoter (not included here). d2'' and the MS2 aptamer are under the control of another rhamnose inducible promoter (included here). false Vir Choksi, Daniel McHugh component2176079 1 BBa_M36130 component2176077 1 BBa_B0040 component2176074 1 BBa_M36129 component2176081 1 BBa_M36135 component2176073 1 BBa_M36128 component2176080 1 BBa_M36127 component2176075 1 BBa_M36135 component2176078 1 BBa_M36136 annotation2176081 1 BBa_M36135 range2176081 1 455 493 annotation2176078 1 BBa_M36136 range2176078 1 240 390 annotation2176079 1 BBa_M36130 range2176079 1 399 424 annotation2176080 1 BBa_M36127 range2176080 1 433 446 annotation2176073 1 BBa_M36128 range2176073 1 1 62 annotation2176075 1 BBa_M36135 range2176075 1 115 153 annotation2176077 1 BBa_B0040 range2176077 1 162 231 annotation2176074 1 BBa_M36129 range2176074 1 71 106 BBa_M36136 1 BBa_M36136 Rhamnose-inducible promoter 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z The rhamnose-inducible promoter is described in Giacolone et al., Biotechniques 2006. We used bases 1951-2101 from BBa_K564001. This is a rhamnose-inducible promoter. We used bases 1951-2101 from BBa_K564001. It is induced by 1000 micromolar rhamnose. false false _848_ 0 13700 9 Not in stock false We used bases 1951-2101 from BBa_K564001. false Vir Choksi BBa_M36130 1 BBa_M36130 d2'' (RNA scaffold) 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z Delebecque et al, Science 2011 d2'' is the second part required for formation of the 2-dimensional RNA scaffold. The 2D RNA assembly D2 forms from d2' and d2'', each followed by a distinct PP7 and MS2 aptamer. The dormant tile d2' spontaneously generates the pro-tile d2-1, which interacts with d2'' to generate tile d2-2. d2-2 then self-assembles into the 2D RNA scaffold D2 with PP7 and MS2 binding domains. false false _848_ 0 13700 9 Not in stock false d2'' is only functional when used along with other parts required for the 2D RNA scaffold. false Vir Choksi BBa_M36127 1 BBa_M36127 MS2 aptamer 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z C. J. Delebecque, A. B. Lindner, P. A. Silver, F. A. Aldaye, ???Organization of intracellular reactions with rationally designed RNA assemblies??? Science 333, 470-474 (2011). Encodes for an RNA sequence which functions as the binding domain for the MS2 bacteriophage coat protein. false false _848_ 0 13699 9 Not in stock false Can be used in the context of the one- and two- dimensional RNA scaffolds described in the Delebecque paper. false Daniel McHugh BBa_B0040 1 spacer Spacer.1 (generic) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Randomly generated and optimized for several parameters (see Design notes). Released HQ 2013 Generic spacer for ensuring a 70 bp distance between the end of the suffix of the BioBrick part containing the double terminator and the prefix of the BioBrick part containing the promoter of the new gene. Please, use the AlignX function of Vector NT to check for homology with the components in your plasmid before using this spacer.</P> false false _1_ 0 24 7 In stock false <P> <P><p>The size of the spacer was choosed to meet the minimum length of a sequence that can be queried using the BLAST search engine. However, subsequences of it can be used to design shorter spacers. The sequence was selected from many more sequences randomly generated using the <a href="http://www.lifesci.ucsb.edu/~maduro/random.htm">Random DNA Generator </a>engine; the GC% parameter used as input was 50%. The sequences were selected based on the following constraints listed in their order of importance: the absence of any putative promoter regions, a low degree of homology with the Elowitz plasmid (whose components are widely used in our designs), no homology with other <em>E.coli</em> sequences as shown by BLASTN search results and the presence of a number of TAA stop codons. The second constraint was the most stringent leading to the elimination of most sequences. </p> <p> DE made the following changes to the original sequence in order to add stop codons in the -3 frame and more in the +2 frame (note, not all of these stop codons are UAA. Thus, if used in an organism that inserts an amino acid @ UGA or UAG the obvious will occur):<br> T->A @ 85<br> T->A @ 42<br> C->T @ 79<br> A->T @ 64<br> A->T @ 31<br> T->A @ 34<br> C->A @ 37<br> Also, note that the above changes further reduce (the already very weak) homology to current NCBI-stored sequences.<br> </p> <P>In the process of selecting the best sequence it appeared that a good alternative sequence for a spacer would be: AGGTTCTGATATGTAACTGTGCCCAATGTCGTTAGTGACGCATACCTCTTAAGAGGCCACTGTCCTAACA. The sequence contains no putative promoters and shows moderate homology with the 5' end of the Ampicillin resistance gene. However a strong promoter sequence starts 12 bp downstream of this sequence, and therefore the sequence presented above was preferred. </p><P> The sequence is compatible (does not show significant homology) with the components in the Elowitz repressilator plasmid. true Vinay S. Mahajan, Brian Chow, Peter Carr annotation7030 1 BBa_B0040 range7030 1 1 70 annotation1721 1 Spacer-1 range1721 1 1 70 BBa_M36129 1 BBa_M36129 PP7 aptamer 2012-05-31T11:00:00Z 2015-05-08T01:14:03Z C. J. Delebecque, A. B. Lindner, P. A. Silver, F. A. Aldaye, ???Organization of intracellular reactions with rationally designed RNA assemblies??? Science 333, 470-474 (2011). Encodes for an RNA sequence which functions as the binding domain for the PP7 bacteriophage coat protein. false false _848_ 0 13699 9 Not in stock false Can be used in the context of the one- and two-dimensional RNA scaffolds described in the Delebecque paper. false Daniel McHugh BBa_B0040_sequence 1 aggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaaca BBa_M36136_sequence 1 gggaaaaagcgggaaatgcggacgacatcacaccggcctattagtagaaactgtgaacgctatcacgttcatctttgccttgttgccagcggctcattttcctgtcagtaacgagaaggtaggtctttgagggcttttttagactgtgcgc BBa_M36128_sequence 1 tcaggaatcctggtgatagctatttggacaattacgtacgtagttgatgacaactacatgaa BBa_M36129_sequence 1 gaattccgaccagaagatatggcttcggttgggttc BBa_M36130_sequence 1 tagttgttatggattcctgatttatg BBa_M36127_sequence 1 ccacagtcactggg BBa_M36135_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_M36131_sequence 1 tcaggaatcctggtgatagctatttggacaattacgtacgtagttgatgacaactacatgaatactagaggaattccgaccagaagatatggcttcggttgggttctactagagaaaaaaaaaccccgcccctgacagggcggggtttttttttactagagaggttctgttaagtaactgaacccaatgtcgttagtgacgcttacctcttaagaggtcactgacctaacatactagaggggaaaaagcgggaaatgcggacgacatcacaccggcctattagtagaaactgtgaacgctatcacgttcatctttgccttgttgccagcggctcattttcctgtcagtaacgagaaggtaggtctttgagggcttttttagactgtgcgctactagagtagttgttatggattcctgatttatgtactagagccacagtcactgggtactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z