BBa_M36152 1 BBa_M36152 nifHDK promoter 2014-10-22T11:00:00Z 2015-05-08T01:14:03Z NifHDK sequence is downstream of nifA sequence and upstream of nifB sequence. Sequence determined from the genome of Azotobacter vinelandii. NifHDK promoter follows the NifA transcription factor and comprises three structural genes nifK,nif D, and nifH. nifK encodes for B-subunit of Component 1 of nitrogenase. nifD encodes for alpha subunit of component 1 of nitrogenase. nifH encodes for component 2 of nitrogenase. false false _848_ 0 24150 9 Not in stock false We selected the genomic region upstream of nifB but following nifA. This is the general region where the nifHDK promoter is found. false Monica Chin BBa_M36152_sequence 1 tgacgggaccctccggcaatggatggccggctcctcccccctccccgttctccccgccccctcgtccgctacggacgcccgtccacgacggacatcgcctccgactcccgccacactgcttgtcgcttgtcgtacagaagcgcgcgaagggcggtgcggatttgtccgttgcgcgacaaattcggcccctcgttttcaaataaatcattcaaaaacaattacttgaataatcggcacgggtattgctcggctcttggggtaaagactctctcagccggagacagaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z