BBa_M36156 1 BBa_M36156 E.coli Cold Shock Promoter (CSP) 2014-10-22T11:00:00Z 2015-05-08T01:14:03Z This part came from the promoter region of the wild- type gyrA gene. The part behaves relatively similar to the heat shock promoter. In the presence of extreme low temperatures, the promoter sequence of is recognized by the protein CS7.4, which is a cold shock transcriptional activator of the genes gyrA and HNS. Once the CS7.4 binds to the cold shock operon, RNA polymerase is recruited to the cold shock promoter region to begin transcription. In sensor based projects, the cold shock promoter should be placed up stream of the gene that the user intends to transcribe. false false _848_ 0 24179 9 Not in stock false This gene is naturally found in E.coli and so is not a sensor that we needed to modify. This part has never been tested but is proven to initiate transcription in E.coli when a cold shock occurs. false Sohaib Shaikh BBa_M36156_sequence 1 agcgtataggtttacctcaaactgcgcggctgtgttataatttgcgacctttgaatcgggatacagtagagggatagcggttagatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z