BBa_M36157 1 BBa_M36157 MeffBlue, Blue Chromoprotein 2014-10-22T11:00:00Z 2015-05-08T01:14:03Z The source for this part is the Part BBa_K1033902, which is the MeffBlue, Blue Chromoprotein. This chromoprotein from Montipora efflorescens, meffBlue (also known as Rtms5), naturally exhibits strong color when expressed. The protein has blue color visible to the naked eye. Compared to many other chromoproteins, the color development is slower requiring 24-64 incubation for the color to be readily observed. It is visible on both LB or on agar plates. false false _848_ 0 24179 9 Not in stock false In designing this part we modified several of the DNA base pairs in the Part BBa_K1033902 in order to avoid palindromes that were over 10 bp in length. The base pairs were modified in such a way to maintain the same Amino Acid sequence as Part BBa_K1033902. false Sohaib Shaikh BBa_M36157_sequence 1 atgtccgtgattgcaacccaaatgacctacaaagtttacatgagcggtaccgttaatggccactactttgaagtcgagggcgacggtaagggtcgtccgtatgagggtgagcagaccgttaagttgacggttacgaaaggtggcccgctgccgttcgcttgggatatcctgagcccacaatgtcaatacggtagcattccttttaccaagtatccggaagatatcccggactatgtgaagcaaagcttcccggaaggcttcacttgggagcgtattatgaactttgaagatggcgcggtctgcacggtgtccaatgacagcagcatccagggtaattgctttacctatcacgtgaagttctcgggtctgaacttcccgccaaatggcccggttatgcagaaaaagacccagggttgggagccgcatagcgaacgtctgttcgcgcgtggtggcatgttgatcggtaacaactttatggcactgaaactggagggtggcggccactacctgtgtgagttcaagaccacgtataaggccaagaaaccggtgaaaatgccgggttaccactacgtcgatcgcaaactggacgtaactaatcataacaaagactacacgagcgtcgaacagtgcgagatttctatcgcgcgcaaaccggttgtggcgtaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z