BBa_M36411 1 BBa_M36411 E. coli lac promoter 2014-10-22T11:00:00Z 2015-05-08T01:14:04Z Gene Designer 2.0 The promoter is a standard promoter provided by the Gene Designer 2.0 software. It is constitutive. false false _848_ 0 24177 9 Not in stock false We needed a constitutive protein. false Rocco Cervantes BBa_M36411_sequence 1 ggctttacactttatgcttccggctcgtatgttgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z