BBa_M36629 1 BBa_M36629 FLAG Epitope 2015-10-23T11:00:00Z 2015-10-24T05:34:12Z The DNA sequence was generated from the amino acid sequence (DYKDDDDK) using IDT Codon Optimizer for E. coli K12. It was then modified to remove certain restriction sites and repeats. Encodes the FLAG epitope, which has the amino acid sequence of DYKDDDDK. Can be added to either the N- or C- terminus of a protein. No start codon included. false false _848_ 29103 29103 9 false 1. Avoid BsaI, BbsI, and BsmBI restriction sites 2. Avoid repeats over 10bp in length. false Benjamin Yeh, Jodie Sheffels, Ali Hoffer BBa_M36629_sequence 1 gattataaagatgacgacgacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z