BBa_M36716 1 BBa_M36716 rubA2 (Rubredoxin 2) 2011-04-27T11:00:00Z 2015-05-08T01:14:06Z Pseudomonas aeruginosa PAO1 rubA2 codes for a protein that supplies reducing electrons for an alkane hydroxylating reaction. false false _848_ 0 9643 9 Not in stock false N/A false Tammy Hsu, Ruby Lee annotation2119189 1 start codon range2119189 1 1 3 annotation2119190 1 stop codon range2119190 1 166 168 BBa_M36716_sequence 1 atgcgcaagtggcaatgcgtggtctgcggcttcatctacgacgaagccctgggcctgcccgaagaaggcattccggcgggaacccgttgggaggacatcccggcggactgggtctgcccggactgcggtgtcggcaagatcgatttcgagatgatcgagatcgcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z