BBa_M36722 1 BBa_M36722 mmoD (methane monooxygenase subunit D) 2011-04-27T11:00:00Z 2015-05-08T01:14:06Z From Methylococcus capsulatus str. Bath http://www.ncbi.nlm.nih.gov/gene?term=mmod mmoD is an open reading frame (orfY) in a methane monooxygenase complex (subunit D). It helps oxidize a C-H bond in methane, converting it to methanol. false false _848_ 0 9643 9 In stock false mmoD needs to work with the gene cluster mmoXYBZDC to create the desired methane monooxygenase function. false Tammy Hsu BBa_M36722_sequence 1 atggtcgaatcggcatttcagccattttcgggcgacgcagacgaatggttcgaggaaccacggccccaggccggtttcttcccttccgcggactggcatctgctcaaacgggacgagacctacgcagcctatgccaaggatctcgatttcatgtggcggtgggtcatcgtccgggaagaaaggatcgtccaggagggttgctcgatcagcctggagtcgtcgatccgcgccgtgacgcacgtactgaattattttggtatgaccgaacaacgcgccccggcagaggaccggaccggcggagttcaacattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z