BBa_M36765 1 BBa_M36765 Optimized Heat Shock Promoter (2x HSE) 2014-10-23T11:00:00Z 2015-05-08T01:14:06Z http://www.ncbi.nlm.nih.gov/pubmed/25168173 This part is an optimized Heat Shock Expression (HSE) promoter that has been developed as a replacement for HSPA1a, a common promoter used for detection of the transcription factor HSF1. These Heat Shock Proteins (HSPs) are crucial for preventing cell death/enhancing survival. In the study where this sequence was developed, the authors describe a repeating sequence of HSE elements, measuring the change in response with respect to number of elements incorporated. Although 5 HSE's were identified to optimize HSP expression, this sequence uses 2 HSE elements. These HSE's are more efficient due to selective detection of Heat Shock pathway activity as opposed to their HSPA1a counterparts which have other confounding stress factors included. false false _848_ 0 24156 9 Not in stock false Because we needed to synthesize this sequence, we only used 2x HSE's due to the repetitive nature of this promoter. If users would like a stronger heat shock recognizing promoter, refer to the source provided. false Shankara Anand BBa_M36765_sequence 1 gtcaagaacgttctagaacgtcaagaacgttctagaacgtcatataaaagcccaggggcaagcggtccggataacggctagcctgaggagctgctgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z