BBa_M36009 1 BBa_M36009 5' Bicistronic UTR (strong), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z c/o Vivek Mutalik et al. BIOFAB Emeryville 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false please see long description. false Drew Endy BBa_M36994 1 BBa_M36994 Type II Secreted Antifreeze Actuator in E. coli (1-Repeat) 2011-04-27T11:00:00Z 2015-05-08T01:14:07Z Based on a protein sequence from the white flounder, Pseudopleuronecta americanus. 5'UTR, signal peptide, non-glycolated antifreeze protein, and terminator that will as whole transcribe and secrete antifreeze protein outside the cell membrane. true false _848_ 0 9543 9 Discontinued false This design has a "ANAAAAAALTA" sequence that is only roughly used once, unlike other AFP sequences which have more repeats of this sequence. false Nathan Barnett, Meghan Bowler, Kian Torabian component2118487 1 BBa_M36009 component2118490 1 BBa_M36010 component2118488 1 BBa_M36726 component2118489 1 BBa_M36997 annotation2118487 1 BBa_M36009 range2118487 1 1 47 annotation2118489 1 BBa_M36997 range2118489 1 130 231 annotation2118490 1 BBa_M36010 range2118490 1 240 321 annotation2118488 1 BBa_M36726 range2118488 1 56 121 BBa_M36726 1 BBa_M36726 Type II Signal Peptide 2011-04-27T11:00:00Z 2015-05-08T01:14:06Z This peptide is a genomic sequence from E. coli. An N-terminus peptide that carries and delivers a protein outside of the cell membrane using the Sec Pathway. false false _848_ 0 9543 9 Not in stock false This is an N-terminal protein that should precede the protein you would like exported. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119866 1 start range2119866 1 1 3 BBa_M36997 1 BBa_M36997 Non-Glycolated Antifreeze Protein (AFP) - 1-Repeated Segment 2011-04-27T11:00:00Z 2016-01-27T10:45:22Z Comes from the white flounder, Pseudopleuronecta americanus. The standard non-glycolated antifreeze protein (AFP) from the Pseudopleuronecta americanus. The codons have been optimized for E. coli. false false _848_ 4206 9543 9 Not in stock false This is a reduced segment of the 5-Repeated Segment AFP, with four "ANAAAAAALTA" taken out. false Nathan Barnett, Meghan Bowler, Kian Torabian annotation2119812 1 c-linker range2119812 1 1 9 annotation2119815 1 Unit 1 (TAANAAAAAAL) range2119815 1 46 78 annotation2119814 1 Modified Unit 0 (TASDAAAAAL) range2119814 1 16 45 annotation2119816 1 stop range2119816 1 91 96 annotation2119813 1 start range2119813 1 10 12 BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36994_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaatactagaggcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaactactagagcccccccccatggacactgcctctgacgccgcagctgcagcactgacagcggctaatgctgctgcagcagcagctttgactgcacggtaataggatccgcgctactagagtcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36726_sequence 1 gcgaccaaactggtgctgggcgcggtgattctgggcagcaccctgctggcgggctgcagcagcaac BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36009_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaa BBa_M36997_sequence 1 cccccccccatggacactgcctctgacgccgcagctgcagcactgacagcggctaatgctgctgcagcagcagctttgactgcacggtaataggatccgcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z