BBa_M45052 1 BBa_M45052 phasin dna 2014-03-24T12:00:00Z 2015-05-08T01:14:08Z dffghh dfghjkkk false false _1855_ 0 20937 9 Not in stock false gghjjjjj false Lei Sun BBa_M45053 1 BBa_M45053 dtyygujj 2014-03-24T12:00:00Z 2015-05-08T01:14:08Z fgyhhhjjjj dggyhhhhu false false _1855_ 0 20937 9 Not in stock false gyuuhh false Lei Sun component2371927 1 BBa_M45052 annotation2371927 1 BBa_M45052 range2371927 1 1 32 BBa_M45053_sequence 1 atgcgtatgcagtcagtcgtcatgctaaatgc BBa_M45052_sequence 1 atgcgtatgcagtcagtcgtcatgctaaatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z