BBa_P10200 1 BBa_P10200 omega tobacco mosaic virus 2016-05-24T11:00:00Z 2016-05-25T05:50:22Z More information to come PhytoBricks part from plasmid pUAP41402 false false _2659_ 8248 8248 9 false More information to come false Traci Haddock-Angelli BBa_P10200_sequence 1 ggtctcatactgtatttttacaacaattaccaacaacaacaaacaacaaacaacattacaattactatttacaattacaatgcgagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z