BBa_R0181 1 BBa_R0181 T7 RNAP promoter 2005-09-25T11:00:00Z 2015-05-08T01:14:15Z T7 promoter with an T->G mutation at the -17 position of the consensus sequence false false _11_6_ 0 135 6 Not in stock false false Barry Canton BBa_R0181_sequence 1 gaatacgactcactatagggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z