BBa_S00160 1 BBa_S00160 R0011+B0100+B0048 2007-03-05T12:00:00Z 2015-05-08T01:14:16Z This part was made by PCR amplification of B0100 from the MG1655 genome with the Biobricks upstream cloning sites (EcoRI and XbaI) and R0011 included in the forward promoter and B0048 and the Biobricks downstream cloning sites (SpeI and PstI) included in the reverse primer. This intermediate part is a composite of parts R0011 (lambda cI promoter with lacI binding sites) + B0100 (OmpA 5' UTR region containing two stabilizing hairpins) + B0048 (AvrII restriction site), formed via blunt cloning (does not contain biobricks mixed sites). false true _11_ 0 571 10 Not in stock false This part was assembled via PCR amplification rather than with standard assembly in order to reduce cloning time (less assembly steps) and for ease of handling (small parts are hard to digest and purify properly). false Heather Keller annotation1920293 1 hp2 range1920293 1 130 158 annotation1920288 1 lacO1 range1920288 1 3 19 annotation1920255 1 R0011 range1920255 1 1 55 annotation1920292 1 hp1 range1920292 1 56 118 annotation1920296 1 ss1 range1920296 1 119 129 annotation1920286 1 R0048 range1920286 1 171 176 annotation1920289 1 -35 range1920289 1 20 25 annotation1920290 1 lacO1 range1920290 1 26 42 annotation1920295 1 AvrII site range1920295 1 171 176 annotation1920287 1 R0100 range1920287 1 56 170 annotation1920294 1 ss2 range1920294 1 159 170 annotation1920291 1 -10 range1920291 1 43 48 BBa_S00160_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacagccaggggtgctcggcataagccgaagatatcggtagagttaatattgagcagatcccccggtgaaggatttaaccgtgttatctcgttggagatattcatggcgtattttggatcctagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z