BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_S01281 1 BBa_S01281 Intermediate part from assembly 236 2003-12-03T12:00:00Z 2015-05-08T01:14:17Z true false _1_ 0 24 7 Discontinued false false Randy Rettberg component941527 1 BBa_B0010 component941554 1 BBa_R0063 component941537 1 BBa_B0012 annotation941554 1 BBa_R0063 range941554 1 138 288 annotation941527 1 BBa_B0010 range941527 1 1 80 annotation941537 1 BBa_B0012 range941537 1 89 129 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_R0063 1 lux pL Promoter (luxR & HSL regulated -- lux pL)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri.</em> Released HQ 2013 The lux cassette of V. fischeri contains a left and a right promoter. The left promoter gives weak constitutive expression of downstream genes.This expression is down-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription from Pr, repressing transcription from Pl</p> false true _1_ 0 24 7 In stock false <P> <P> This promoter is based on the Vibrio fischeri quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below.Includes most of Lux reulatory region, including the LuxR binding site which activates the right promoter. A putative LuxR autorepression binding site is also identified adjacent to the -10 site of the right promoter. This 2nd site has 55% identity with the first site. Putative inverted repeats (of size 18-27 bp) also exist between these two sites (not marked above), which may represent binding sites for other regulatory proteins. <p><img src="<bb_file>Image01.gif</bb_file>" width="614" height="362"><P>Unspecified. true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2053 1 -35 range2053 1 89 94 annotation2052 1 -10 range2052 1 115 122 annotation7071 1 BBa_R0063 range7071 1 1 151 annotation2054 1 start range2054 1 128 128 annotation2055 1 Putative LuxR/HSL range2055 1 130 149 annotation2051 1 LuxR/HSL range2051 1 1 20 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0063_sequence 1 acctgtacgatcctacaggtgcttatgttaagtaattgtattcccagcgatacaatagtgtgacaaaaatccaatttattagaatcaaatgtcaatccattaccgttttaatgatatataacacgcaaaacttgcgacaaacaataggtaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_S01281_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagacctgtacgatcctacaggtgcttatgttaagtaattgtattcccagcgatacaatagtgtgacaaaaatccaatttattagaatcaaatgtcaatccattaccgttttaatgatatataacacgcaaaacttgcgacaaacaataggtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z