BBa_R0050 1 cI HK022 Promoter (HK022 cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Bacteriophage HK022. The pR regulatory region is a 98 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two operator sites at which HK022 cI protein can bind cooperatively. The -35 and -10 regions from pR are included along with some flanking sequences. The cutoff for the 5' end of the regulatory region was placed just after the pM -10 region which promotes transcription of a gene upstream (thus the pM -10 region is not included). The cutoff for the 3' end of the regulatory region was placed immediately prior to the RBS. </p> false false _1_ 0 24 7 It's complicated false <P> <P>Derived from <genbank>STHK022N</genbank>.<P> Literature claims that there is no cross-talk between HK022 cI regulatory region, Lambda cI, 434 cI and P22 cI, but this has not been verified experimentally by the synthetic biology group at MIT. false Reshma Shetty annotation2012 1 -35 range2012 1 8 13 annotation7066 1 BBa_R0050 range7066 1 1 55 annotation2015 1 OR1 range2015 1 37 51 annotation2014 1 -10 range2014 1 30 35 annotation2013 1 OR2 range2013 1 13 27 annotation2018 1 putative range2018 1 43 43 BBa_C0050 1 cI HK022 cI repressor from phage HK022 (+LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage HK022. Released HQ 2013 Coding region for the HK022 bacteriophage cI protein. cI binds to the HK022 pR regulator (BBa_R0050). It represses transcription of the protein encoded by the sequence 3' to the pR region. This coding sequence does not contain a RBS.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Carlson NG, Little JW. Highly cooperative DNA binding by the coliphage HK022 repressor. J Mol Biol. 1993 Apr 20;230(4):1108-30.<br> PMID: 8487297.</P> <P> Mao C, Little JW. Mutations affecting cooperative DNA binding of phage HK022 CI repressor.<br> J Mol Biol. 1998 May 29;279(1):31-48. PMID: 9636698.</P> <p></p> <p></p> <P> References (unparsed) here: <p>Carlson NG, Little JW. Highly cooperative DNA binding by the coliphage HK022 repressor. J Mol Biol. 1993 Apr 20;230(4):1108-30.<br> PMID: 8487297.</P> <P> Mao C, Little JW. Mutations affecting cooperative DNA binding of phage HK022 CI repressor.<br> J Mol Biol. 1998 May 29;279(1):31-48. PMID: 9636698.</P> <p></p> <p></p> <P>Derived from <genbank>STHK022N</genbank>.<br> <br> Response from John Little (Arizona) regarding the start of HK022 cI<br> <br> From: <jlittle@email.arizona.edu> <br> Date: Tue Jan 21, 2003 4:39:21 PM US/Eastern <br> To: "Drew Endy" <endy@MIT.EDU><br> Subject: RE: hk022 cI start (naive question)? <br> Hello Drew and Michael, I seriously doubt that the extra 27 aa are part of CI. It doesn't make sense in terms of the biology, for sure. In any case, the protein we characterized starts where Carlson and Little stated; as I recall, oR3 partially overlaps the start of cI. I have a vague memory of some possibly interesting biology, having to do with multicopy plasmids. I don't recall the findings themselves. Anyway, one possible explanation was that this extra N-terminal addition was made (e.g. from the pRE promoter, or from a message that arose from transcription around the entire plasmid), making a protein with altered functions. We never followed it up. <br> Good luck <br> John<br> <br> -- Original Message -- <br> Date: Sun, 19 Jan 2003 15:26:26 -0500 <br> Subject: hk022 cI start (naive question)? <br> Cc: elowitm@rockefeller.edu <br> To: jlittle@u.arizona.edu <br> From: Drew Endy <endy@MIT.EDU> <br> Hi John, I'm sitting here with Michael Elowitz and we're working through the sequence for HK022 cI. We noticed that the annotation from NC_002166 includes an "extra" 81 base pairs upstream of what we thought of as the actual start. It looks like this extra DNA extends into the PR regulatory region. We're wondering what's going on here? I'm guessing this is well documented somewhere. Thanks for any pointers/info! <br> Drew<P> It is unknown whether there is cross-talk between this repressor and Lambda cI regulatory region, 434 cI regulatory region and P22 regulatory region. true Reshma Shetty annotation1734 1 2 range1734 1 739 744 annotation7033 1 BBa_C0050 range7033 1 1 744 annotation2213990 1 Help:Barcodes range2213990 1 745 769 annotation1736 1 SsrA range1736 1 706 738 annotation1737 1 OR3 partial range1737 1 1 8 annotation1735 1 cI HK022 range1735 1 1 744 BBa_S01451 1 BBa_S01451 Intermediate part from assembly 243 2003-12-05T12:00:00Z 2015-05-08T01:14:18Z true false _1_ 0 24 7 Discontinued false false Jennifer Braff component956982 1 BBa_B0010 component956959 1 BBa_B0034 component957008 1 BBa_R0050 component956992 1 BBa_B0012 component956954 1 BBa_I0500 component956974 1 BBa_C0050 annotation956959 1 BBa_B0034 range956959 1 1219 1230 annotation956954 1 BBa_I0500 range956954 1 1 1210 annotation956974 1 BBa_C0050 range956974 1 1237 1980 annotation956982 1 BBa_B0010 range956982 1 2014 2093 annotation956992 1 BBa_B0012 range956992 1 2102 2142 annotation957008 1 BBa_R0050 range957008 1 2151 2205 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I0500 1 pBad/araC Inducible pBad/araC promoter 2003-12-05T12:00:00Z 2015-08-31T04:07:29Z -- No description -- false true _1_ 0 24 7 In stock false true Sri Kosuri annotation1498842 1 PC range1498842 1 1043 1114 annotation1498843 1 AraC range1498843 1 1 1079 annotation1498841 1 Pbad range1498841 1 1080 1210 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0050_sequence 1 ttaggtattgactgtactatcagttccgtcataatatgaaccataagttcaccac BBa_I0500_sequence 1 ttatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttgggctagc BBa_S01451_sequence 1 ttatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttgggctagctactagagaaagaggagaaatactagatggttcaacagaaagagcgtgaaactttctcgcagaggcttgcgctggcctgtgataaagcgggattacctttgcatggtaggcaggctgatttagctgtcaggcttaaggtcacaccaaaagccattagtaaatggttcaacggggagtcaataccaagaaaagacaagatggaatctctggcttcggtgctgggaactactgctgcatatctgcatggctatgctgatgatgacggtatcacggtaaatcatctatcaagatcaaatgattattatcgtgttgatgtattggatgttcaggcgagcgccgggccaggaaccatggtttccaatgaatttatagaaaagataagagcaattgaatatacgaccgagcaggcaagaattttatttaatggaaggccacaggaaagcgtaaaagtcatcacggttcgcggtgacagcatggagggaaccatcaatccgggagatgagatctttgttgatgtatccataacctgttttgatggcgatggcatttatgtgtttgtatacgggaaaacaatgcacgttaagcgcctgcaaatgcaaaagaacaggcttgccgtcatctctgacaatgccgcttatgatcgatggtacatagaagaaggtgaagaagagcaacttcacattctagccaaagtcctcattaggcagtcaatcgattacaagcgattcggagctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttaggtattgactgtactatcagttccgtcataatatgaaccataagttcaccac BBa_C0050_sequence 1 atggttcaacagaaagagcgtgaaactttctcgcagaggcttgcgctggcctgtgataaagcgggattacctttgcatggtaggcaggctgatttagctgtcaggcttaaggtcacaccaaaagccattagtaaatggttcaacggggagtcaataccaagaaaagacaagatggaatctctggcttcggtgctgggaactactgctgcatatctgcatggctatgctgatgatgacggtatcacggtaaatcatctatcaagatcaaatgattattatcgtgttgatgtattggatgttcaggcgagcgccgggccaggaaccatggtttccaatgaatttatagaaaagataagagcaattgaatatacgaccgagcaggcaagaattttatttaatggaaggccacaggaaagcgtaaaagtcatcacggttcgcggtgacagcatggagggaaccatcaatccgggagatgagatctttgttgatgtatccataacctgttttgatggcgatggcatttatgtgtttgtatacgggaaaacaatgcacgttaagcgcctgcaaatgcaaaagaacaggcttgccgtcatctctgacaatgccgcttatgatcgatggtacatagaagaaggtgaagaagagcaacttcacattctagccaaagtcctcattaggcagtcaatcgattacaagcgattcggagctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z