BBa_I1031 1 BBa_I1031 CI(1) &quot;KISS&quot; asRNA 2003-01-31T12:00:00Z 2015-08-31T04:07:29Z see references Region which serves as basis for transcription of asRNA that binds to and inhibits <bb_part>BBa_I1030</bb_part>'s mRNA transcript. Has LacO-1 regulatory region with promoter. Part of the XOR gate comprised of <bb_part>BBa_I1030</bb_part> and <bb_part>BBa_I1040</bb_part>, their corresponding asRNA coding sequences (<bb_part>BBa_I1011</bb_part> and <bb_part>BBa_I1031</bb_part>). false false _1_ 0 24 7 It's complicated false <P> <P>Complementary to beginning of <bb_part>BBa_I1030</bb_part> transcript covering junk region, RBS, start codon, and 73 bp into coding sequence. No designed secondary structure. [<A href="http://biobricks.ai.mit.edu/BB_References.htm#KEIL96">KEIL96</A>] <P> Incompatible with systems containing <bb_part>BBa_I1032</bb_part> <br>Compatible with <bb_part>BBa_I1020</bb_part>, <bb_part>BBa_I1021</bb_part>, <bb_part>BBa_I1022</bb_part>, <bb_part>BBa_I1023</bb_part>. false Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation1885 1 LacO-1 range1885 1 1 55 annotation7051 1 BBa_I1031 range7051 1 1 163 annotation1884 1 antisense region for I1030 range1884 1 56 163 BBa_S03324 1 BBa_S03324 --Specify Parts List-- 2005-08-23T11:00:00Z 2015-05-08T01:14:21Z R0010. I1031 true false _41_ 0 386 41 Discontinued false false Lucy Zhang component1668672 1 BBa_I1031 component1668658 1 BBa_R0010 annotation1668658 1 BBa_R0010 range1668658 1 1 200 annotation1668672 1 BBa_I1031 range1668672 1 209 371 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_S03324_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcacttcataaattgctttaaggcgacgtgcgtcctcaagctgctcttgtgttaatggtttcttttttgtcgacatcgaaccggtttcctgtcgttgctgttgtgcaaagct BBa_I1031_sequence 1 ataaatgtgagcggataacattgacattgtgagcggataacaagatactgagcacttcataaattgctttaaggcgacgtgcgtcctcaagctgctcttgtgttaatggtttcttttttgtcgacatcgaaccggtttcctgtcgttgctgttgtgcaaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z