BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J32004 1 ccdA CcdA 2006-07-10T11:00:00Z 2015-08-31T04:08:45Z Neisseria gonorrhoeae NCBI Accession AE004969 The last 1233 base pairs of Neisseria gonorrhoeae IgA Protease. false false _50_ 0 495 50 Not in stock false fusion protein false Austen Heinz annotation1884532 1 J32004 range1884532 1 1 219 BBa_S03506 1 BBa_S03506 B0034:J32004 2006-07-16T11:00:00Z 2015-05-08T01:14:24Z Released HQ 2013 false false _50_ 0 495 50 In stock true true Austen Heinz component1885772 1 BBa_B0034 component1885774 1 BBa_J32004 annotation1885774 1 BBa_J32004 range1885774 1 19 237 annotation1885772 1 BBa_B0034 range1885772 1 1 12 BBa_S03506_sequence 1 aaagaggagaaatactagatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtga BBa_B0034_sequence 1 aaagaggagaaa BBa_J32004_sequence 1 atgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z