BBa_S03514 1 BBa_S03514 HinLVA : TT 2006-07-20T11:00:00Z 2015-05-08T01:14:24Z false false _61_ 0 919 61 It's complicated false false Davidson and Missouri Western component2219337 1 BBa_J31001 component2219344 1 BBa_B0015 annotation2219344 1 BBa_B0015 range2219344 1 621 749 annotation2219337 1 BBa_J31001 range2219337 1 1 612 BBa_J31001 1 Hin LVA DNA invertase Hin tagged with LVA 2006-07-11T11:00:00Z 2015-08-31T04:08:45Z Salmonella typhimurium and the the Hin part without LVA. This part produces the Hin protein with an LVA degredation tag. We are currently looking into this as a way to ensure no Hin is floating around once we turn off the Hin promoter. false false _61_ 0 918 61 In stock true None really false Erin Zwack, Sabriya Rosemond annotation1910570 1 Rev primer J31001 range1910570 1 551 612 annotation1910567 1 Stop codon range1910567 1 610 612 annotation1910565 1 Fwd primer J31001 range1910565 1 1 3 annotation1910564 1 Hin range1910564 1 1 570 annotation1910566 1 LVA range1910566 1 571 609 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S03514_sequence 1 atggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaggaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgagcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgcagcgtgaaaaacctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaattgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacagacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaactagctattatttttggtattggcgtatctaccttatacagatattttccggcaagccgtataaaaaaacgaatgaataggcctgctgcaaacgacgaaaactacgctttagtagcttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J31001_sequence 1 atggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaggaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgagcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgcagcgtgaaaaacctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaattgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacagacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaactagctattatttttggtattggcgtatctaccttatacagatattttccggcaagccgtataaaaaaacgaatgaataggcctgctgcaaacgacgaaaactacgctttagtagcttaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z