BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 BBa_J31000 1 Hin DNA-invertase Hin from Salmonella typhimurium 2006-06-04T11:00:00Z 2015-08-31T04:08:45Z Salmonella typhimurium Generates the Salmonella typhimurium Hin protein. This protein is used to invert DNA that is flanked by Hix siteds. false false _61_ 0 918 61 It's complicated false none really false Erin Zwack, Sabriya Rosemond annotation1880460 1 Mutation to delete the SpeI site range1880460 1 72 72 annotation1884987 1 Hin sequence range1884987 1 1 573 annotation1910568 1 Fwd primer J31001 range1910568 1 1 3 annotation1910569 1 Rev primer J31001 range1910569 1 551 570 annotation1880459 1 Former SpeI site range1880459 1 70 75 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_S03537 1 BBa_S03537 pLac-RBS-Hin-TT 2006-08-02T11:00:00Z 2015-05-08T01:14:24Z false false _71_ 0 966 71 It's complicated false false Lane Heard component1893311 1 BBa_B0010 component1893305 1 BBa_B0030 component1893297 1 BBa_R0010 component1893313 1 BBa_B0012 component1893310 1 BBa_J31000 annotation1893297 1 BBa_R0010 range1893297 1 1 200 annotation1893311 1 BBa_B0010 range1893311 1 811 890 annotation1893313 1 BBa_B0012 range1893313 1 899 939 annotation1893305 1 BBa_B0030 range1893305 1 209 223 annotation1893310 1 BBa_J31000 range1893310 1 230 802 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0030_sequence 1 attaaagaggagaaa BBa_S03537_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagattaaagaggagaaatactagatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaagaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgggcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgtagcgtgaaaaatctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaatcgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacaaacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaattagctattatttttggtattggcgtatccaccttatacagatactttccggcaagcagtataaaaaaacgaatgaattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J31000_sequence 1 atggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaagaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgggcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgtagcgtgaaaaatctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaatcgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacaaacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaattagctattatttttggtattggcgtatccaccttatacagatactttccggcaagcagtataaaaaaacgaatgaattaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z