BBa_J44000 1 hixC hixC binding site for Salmonella typhimurium Hin recombinase 2006-06-05T11:00:00Z 2015-08-31T04:08:48Z Nanassy and Hughes. 1998. In Vivo Identification of Intermediate Stages of the DNA Inversion Reaction Catlyzed by the Salmonella Hin Recombinase [http://www.genetics.org/cgi/content/abstract/149/4/1649] A 26 bp sequence of DNA composed of 12 bp inverted repeats and a 2 bp core that operates in Salmonella paired with a hixR binding site to recombine DNA. A second hix site is required for recombination to occur. The two sites bind Hin recombinase in the formation of an invertasome. false true _71_ 0 606 61 In stock true Standard BioBrick prefix and suffix were added to the 26 bp sequence. true Missouri Western and Davidson Groups, Todd Eckdahl BBa_S03561 1 BBa_S03561 pBADrev-hixC 2006-08-15T11:00:00Z 2015-05-08T01:14:24Z false false _71_ 0 815 71 It's complicated false false Adam Brown component1897627 1 BBa_J44002 component1897628 1 BBa_J44000 annotation1897627 1 BBa_J44002 range1897627 1 1 130 annotation1897628 1 BBa_J44000 range1897628 1 139 164 BBa_J44002 1 BBa_J44002 pBAD reverse 2006-08-15T11:00:00Z 2015-08-31T04:08:48Z Cloned from synthetic oligonucleotides. This is the pBAD promoter (BBa_I13453) in the opposite orientation. It can be used to drive transcription in the direction of suffix to prefix. false false _71_ 0 811 71 In stock true None. true Brad Ogden annotation2002776 1 promoter range2002776 1 1 130 BBa_S03561_sequence 1 gctagcccaaaaaaacggtatggagaaacagtagagagttgcgataaaaagcgtcaggtaggatccgctaatcttatggataaaaatgctatggcatagcaaagtgtgacgccgtgcaaataatcaatgttactagagttatcaaaaaccatggtttttgataa BBa_J44000_sequence 1 ttatcaaaaaccatggtttttgataa BBa_J44002_sequence 1 gctagcccaaaaaaacggtatggagaaacagtagagagttgcgataaaaagcgtcaggtaggatccgctaatcttatggataaaaatgctatggcatagcaaagtgtgacgccgtgcaaataatcaatgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z