BBa_J44002 1 BBa_J44002 pBAD reverse 2006-08-15T11:00:00Z 2015-08-31T04:08:48Z Cloned from synthetic oligonucleotides. This is the pBAD promoter (BBa_I13453) in the opposite orientation. It can be used to drive transcription in the direction of suffix to prefix. false false _71_ 0 811 71 In stock true None. true Brad Ogden annotation2002776 1 promoter range2002776 1 1 130 BBa_J44000 1 hixC hixC binding site for Salmonella typhimurium Hin recombinase 2006-06-05T11:00:00Z 2015-08-31T04:08:48Z Nanassy and Hughes. 1998. In Vivo Identification of Intermediate Stages of the DNA Inversion Reaction Catlyzed by the Salmonella Hin Recombinase [http://www.genetics.org/cgi/content/abstract/149/4/1649] A 26 bp sequence of DNA composed of 12 bp inverted repeats and a 2 bp core that operates in Salmonella paired with a hixR binding site to recombine DNA. A second hix site is required for recombination to occur. The two sites bind Hin recombinase in the formation of an invertasome. false true _71_ 0 606 61 In stock true Standard BioBrick prefix and suffix were added to the 26 bp sequence. true Missouri Western and Davidson Groups, Todd Eckdahl BBa_S03637 1 BBa_S03637 HixC : pBad_rev-HixC 2006-10-27T11:00:00Z 2015-05-08T01:14:26Z false false _61_ 0 1144 61 It's complicated false false Karmella Haynes component1908162 1 BBa_J44000 component1908163 1 BBa_J44002 component1908164 1 BBa_J44000 annotation1908163 1 BBa_J44002 range1908163 1 35 164 annotation1908162 1 BBa_J44000 range1908162 1 1 26 annotation1908164 1 BBa_J44000 range1908164 1 173 198 BBa_J44000_sequence 1 ttatcaaaaaccatggtttttgataa BBa_J44002_sequence 1 gctagcccaaaaaaacggtatggagaaacagtagagagttgcgataaaaagcgtcaggtaggatccgctaatcttatggataaaaatgctatggcatagcaaagtgtgacgccgtgcaaataatcaatgt BBa_S03637_sequence 1 ttatcaaaaaccatggtttttgataatactagaggctagcccaaaaaaacggtatggagaaacagtagagagttgcgataaaaagcgtcaggtaggatccgctaatcttatggataaaaatgctatggcatagcaaagtgtgacgccgtgcaaataatcaatgttactagagttatcaaaaaccatggtttttgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z