BBa_K258004 1 BBa_K258004 Keratinocyte growth factor (KGF) 2009-10-03T11:00:00Z 2015-05-08T01:11:42Z Gene was synthesized at GENEART. Keratinocyte growth factor (KGF) is a locally acting epithelial mitogen that is produced by cells of mesenchymal origin and has an important role in protecting and repairing epithelial tissues.Use of recombinant human KGF (palifermin) in patients with hematologic malignancies reduces the incidence and duration of severe oral mucositis experienced after intensive chemoradiotherapy. These results suggest that KGF may be useful in the treatment of patients with other kinds of tumors, including those of epithelial origin.[1]The potential effect of KGF on wound healing was assessed in vitro by measuring randomized migration and plasminogen activator (PA) activity of keratinocytes in response to the growth factor. Incubation of normal human keratinocytes with KGF in modified MCDB 153 medium significantly stimulated cell migration[2] The Keratinocyte Growth Factor (KGF), also known as FGF7, is a growth factor present in the epithelialization-phase of wound healing. In this phase, keratinocytes are covering the wound, forming the epithelium.[3] . KGF is weakly expressed in human skin, but is strongly upregulated in dermal fibroblasts after skin injury. Its binding to a transmembrane receptor on keratinocytes induces proliferation and migration of these cells. Furthermore, KGF has been shown to protect epithelial cells from the toxic effects of reactive oxygen species. We have identified a series of KGF-regulated genes that are likely to play a role in these processes. In addition to KGF, activin seems to be a novel player in wound healing.[4] false false _358_ 0 4260 9 It's complicated true The gene is in pMA vector having biobrick restriction sites(Ecor1, Xba1 and Spe1,Pst1,respectively) false Ozkan IS BBa_S04285 1 BBa_S04285 K258004:K258001 2009-10-08T11:00:00Z 2015-05-08T01:14:37Z false false _9_ 0 4260 9 Not in stock false false Cihan Tastan component2032909 1 BBa_K258004 component2032910 1 BBa_K258001 annotation2032909 1 BBa_K258004 range2032909 1 1 492 annotation2032910 1 BBa_K258001 range2032910 1 501 1028 BBa_K258001 1 BBa_K258001 Lipase ABC transporter recognition domain (LARD 1) 2009-10-02T11:00:00Z 2015-05-08T01:11:42Z LARD 1 composed of residues 303-476 of thermostable lipase (TliA) of Pseudomonas fluorescens. Lard 1 was designed for the secretion of fusion proteins.The LARD 1 included four glycine-rich repeats comprising a β-roll structure, and were added to the C-terminus of test proteins. Either Pro-Gly linker or Factor Xa site can be added between fusion proteins and LARD 1. Upon supplementation of E. coli with ABC transporter from E. chrysanthemi (ABC transporter PrtDEF), which function well in the phylogenetically-neighboring genus E.coli, EGF-LARDs were excreted into the culture supernatant. false false _358_ 0 4260 9 It's complicated true In our designed LARD 1, we favoured not to add these cleavage site so if you want, yo can add either Pro-Gly linker or Factor Xa site. Secretion of fusion proteins with LARDs could be detected by Western blotting. Fusion proteins were traced in the culture supernatant using antibody against LARDs. Polyclonal antibodies against the C-terminal signal sequence were produced with a synthetic peptide (YQPTDRLVFQGADGST, residues 421???436 of TliA ,also of LARD). false Jung Hoon Ahn from Korea Advanced Institute of Science and Technology BBa_K258004_sequence 1 atgtgtaacgacatgacccctgagcaaatggcaacaaacgtgaactgtagtagtcctgaacgccacactcgctcttatgattatatggagggcggggatattcgtgttcgtcgcctgttctgccgtactcaatggtatctgcgcatcgataaacgtggtaaagtgaaaggcacccaagaaatgaaaaacaactataacatcatggaaatccgtaccgtggcagttggtattgtagcgatcaaaggcgtggaatccgagttctatctggcaatgaacaaagagggcaaactgtatgccaaaaaagagtgtaacgaggactgtaacttcaaagaactgatcctggagaaccattataacacctatgccagcgccaaatggacccataacggtggtgaaatgttcgtggccctgaaccaaaaaggcattccggtccgtggcaaaaaaacgaaaaaagagcagaaaaccgcccacttcctgcctatggccattaca BBa_S04285_sequence 1 atgtgtaacgacatgacccctgagcaaatggcaacaaacgtgaactgtagtagtcctgaacgccacactcgctcttatgattatatggagggcggggatattcgtgttcgtcgcctgttctgccgtactcaatggtatctgcgcatcgataaacgtggtaaagtgaaaggcacccaagaaatgaaaaacaactataacatcatggaaatccgtaccgtggcagttggtattgtagcgatcaaaggcgtggaatccgagttctatctggcaatgaacaaagagggcaaactgtatgccaaaaaagagtgtaacgaggactgtaacttcaaagaactgatcctggagaaccattataacacctatgccagcgccaaatggacccataacggtggtgaaatgttcgtggccctgaaccaaaaaggcattccggtccgtggcaaaaaaacgaaaaaagagcagaaaaccgcccacttcctgcctatggccattacatactagagagcattgccaacctgtccacatgggtgtcacatctgccttcagcctatggtgatggtatgactcgtgtgctggaatctggcttttatgagcaaatgactcgtgatagtacgattattgtcgctaacctgtctgatccggctcgtgccaacacttgggttcaagacctgaaccgtaatgctgaacctcatacgggtaacacctttatcattgggtccgatgggaacgatctgattcaaggcggcaaaggagcggatttcatcgagggtggaaaaggcaacgacaccatccgtgacaattctgggcataacacgtttctgttttcgggccattttggtcaggatcgtatcatcggctatcagccgaccgatcgtctggtgtttcaaggtgctgatggttcaaccgatctgcgtgatcatgccaaagcagttggtgccgacacagttctgtcttttggagctgactcagtgactctggtgggagttggtctgggtggtctgtggtctgagggtgtactgattagctactag BBa_K258001_sequence 1 agcattgccaacctgtccacatgggtgtcacatctgccttcagcctatggtgatggtatgactcgtgtgctggaatctggcttttatgagcaaatgactcgtgatagtacgattattgtcgctaacctgtctgatccggctcgtgccaacacttgggttcaagacctgaaccgtaatgctgaacctcatacgggtaacacctttatcattgggtccgatgggaacgatctgattcaaggcggcaaaggagcggatttcatcgagggtggaaaaggcaacgacaccatccgtgacaattctgggcataacacgtttctgttttcgggccattttggtcaggatcgtatcatcggctatcagccgaccgatcgtctggtgtttcaaggtgctgatggttcaaccgatctgcgtgatcatgccaaagcagttggtgccgacacagttctgtcttttggagctgactcagtgactctggtgggagttggtctgggtggtctgtggtctgagggtgtactgattagctactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z