BBa_S05020 1 BBa_S05020 J119032:J119024 2012-01-09T12:00:00Z 2015-05-08T01:14:48Z false false _61_ 0 201 61 Not in stock false false Malcolm Campbell component2169348 1 BBa_J119024 component2169342 1 BBa_J119032 annotation2169348 1 BBa_J119024 range2169348 1 36 123 annotation2169342 1 BBa_J119032 range2169342 1 1 35 BBa_J119024 1 BBa_J119024 BD18 bicistronic translational junction - Medium effiency 2011-12-21T12:00:00Z 2015-10-01T11:42:24Z Synthetic DNA. The BD18 bicistronic translational junction was engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. It includes an RBS that allows translation of a leader polypeptide. The leader has a second RBS embedded in it. The stop codon for the leader polypeptide overlaps with the start codon for the gene of interest. false false _613_ 606 606 61 Not in stock false The BD18 bicistronic translational junction was designed to give reproducible and consistent expression for various genes of interest. false Vivek Mutalik annotation2167440 1 leader RBS range2167440 1 19 27 annotation2167441 1 Start range2167441 1 33 35 annotation2167443 1 Start range2167443 1 86 88 annotation2167442 1 Stop range2167442 1 84 86 annotation2167444 1 GOI RBS range2167444 1 71 79 BBa_J119032 1 BBa_J119032 P9 Promoter - Low efficiency 2011-12-22T12:00:00Z 2015-10-01T11:40:54Z Synthetic DNA. P9 promoter engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false false _613_ 606 606 61 Not in stock false Designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org] for use in testing bicistronic translational junctions (eg. http://partsregistry.org/Part:BBa_J119024). false Vivek Mutalik BBa_J119024_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgacggagcgtttctaatg BBa_J119032_sequence 1 ttgcctcttaatcatcggctcgtataatgtgtgga BBa_S05020_sequence 1 ttgcctcttaatcatcggctcgtataatgtgtggagggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgacggagcgtttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z