BBa_T2010 1 HA tag hemagglutinin (HA) tag head domain (YPYDVPDYA) 2009-08-10T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a HA tag head domain designed to be at the N-terminus of a protein. HA tags are a type of affinity tag that can be used to purify and/or measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false This domain encodes the HA sequence YPYDVPDYA. The codons at each amino acid position were selected to avoid rare codons as much as possible in organisms like ''E. coli'', humans, mouse, ''B. subtilis'', ''C. elegans'', ''Streptomyces coelicolor'' and other common model organisms and/or industrial hosts. Another factor in codon selection was avoiding avoid repeat sequences. false Reshma Shetty annotation2017185 1 HA tag range2017185 1 7 33 annotation2017308 1 preferred AAA +2 codon range2017308 1 4 6 annotation2017184 1 start codon range2017184 1 1 3 BBa_T2010_sequence 1 atgaaatacccttatgacgtgcctgattacgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z