BBa_T2015 1 S-tag S-tag tail domain (KETAAAKFERQHMDS) 2009-09-01T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a S-tag tail domain designed to be at the C-terminus of a protein. S-tags are a type of affinity tag that can be used to purify and/or measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false Included a double TAATAA stop codon. false Reshma Shetty annotation2018265 1 S-tag range2018265 1 1 45 annotation2018266 1 double stop codon range2018266 1 46 51 BBa_T2015_sequence 1 aaggagaccgcggccgcgaaattcgaacgccaacacatggactcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z