BBa_T2017 1 S-tag S-tag special internal domain (KETAAAKFERQHMDS) 2009-09-02T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a S-tag special internal domain designed to between protein domains. S-tags are a type of affinity tag that can be used to purify and/or measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false Rare codons from various model organisms were avoided where possible. false Reshma Shetty annotation2018274 1 S-tag range2018274 1 1 45 BBa_T2017_sequence 1 aaggagaccgcggccgcgaaattcgaacgccaacacatggactcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z