BBa_T2019 1 V5 tag V5 epitope tag head domain (GKPIPNPLLGLDST) 2009-09-02T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a V5 epitope tag head domain designed to be at the N-terminus of a protein. V5 tags are a type of epitope tag that can be used to measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false This head domain begins with Met-Lys to promote efficient translation of the protein in E. coli. Rare codons from various model organisms were avoided where possible. false Reshma Shetty annotation2018277 1 start codon range2018277 1 1 3 annotation2018278 1 preferred AAA +2 codon range2018278 1 4 6 annotation2018279 1 V5 epitope tag range2018279 1 7 48 BBa_T2019_sequence 1 atgaaaggtaagccgatcccgaacccgctcctgggcctcgattccacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z