BBa_T2020 1 V5 tag V5 epitope tag special internal domain (GKPIPNPLLGLDST) 2009-09-02T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a V5-tag special internal domain designed to between protein domains. V5 tags are a type of epitope tag that can be used to measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false Rare codons from common model organisms were avoided. false Reshma Shetty annotation2018280 1 V5 epitope tag range2018280 1 1 42 BBa_T2020_sequence 1 ggtaagccgatcccgaacccgctcctgggcctcgattccacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z