BBa_T2021 1 VSV-G tag VSV-G epitope tag tail domain (YTDIEMNRLGK) 2009-09-02T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence This is a VSV-G epitope tag tail domain designed to be at the C-terminus of a protein. VSV-G tags are a type of epitope tag that can be used to measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false A double TAA TAA stop codon was used. Rare codons from model organisms were avoided where possible. false Reshma Shetty annotation2018282 1 double TAA stop codon range2018282 1 34 39 annotation2018281 1 VSV-G epitope tag range2018281 1 1 33 BBa_T2021_sequence 1 tataccgatatcgagatgaaccgcctgggtaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z