BBa_T2022 1 VSV-G tag VSV-G epitope tag special internal domain (YTDIEMNRLGK) 2009-09-02T11:00:00Z 2015-05-08T01:14:52Z This is a synthetic sequence. This is a VSV-G epitope tag special internal domain designed to be used between protein domains. VSV-G tags are a type of epitope tag that can be used to measure the quantity of proteins. false false _41_ 0 126 162 Not in stock false Rare codons from model organisms were avoided where possible. false Reshma Shetty annotation2018283 1 VSV-G tag range2018283 1 1 33 BBa_T2022_sequence 1 tataccgatatcgagatgaaccgcctgggtaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z