BBa_Z0103 1 BBa_Z0103 T7 gene 0.5 2005-04-04T11:00:00Z 2015-05-08T01:14:54Z T7 genome reannotation open reading frame for gene 0.5 from wild-type T7 genome false false _10_ 0 250 10 Not in stock false false T7.2 annotation1476439 1 -10 region of host B promoter range1476439 1 6 11 annotation1476440 1 start site of host B promoter range1476440 1 18 18 BBa_Z0103_sequence 1 atgtatatgcttactatcggtctactcaccgctctaggtctagctgtaggtgcatcctttgggaaggctttaggtgtagctgtaggttcctactttaccgcttgcatcatcataggaatcatcaaaggggcactacgcaaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z