BBa_Z0272 1 BBa_Z0272 T7.2 Tphi transcriptional terminator 2006-05-15T11:00:00Z 2015-05-08T01:14:55Z Taken 10 bp before expected start of stem loop structure, and 3bp after expected stop of transcription (7bp after stem loop) false false _11_10_ 0 64 10 Not in stock false false Sriram Kosuri annotation1862785 1 terminator stem loop range1862785 1 11 46 BBa_Z0272_sequence 1 taactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z