BBa_K1351023

BBa_K1351023 Version 1

Component

Source: http://parts.igem.org/Part:BBa_K1351023

Generated By: https://synbiohub.org/public/igem/igem2sbol/1

Created by: Patrick Reith

Date created: 2014-10-03 11:00:00

Date modified: 2015-05-08 01:10:01

upp cassette as counter-selection marker

Details

• Types: DnaRegion
• Roles: CDS; Coding
• Sequences: BBa_K1351023_sequence (Version 1)

Description

Catalyzes the conversion of uracil and 5-phospho-alpha-D-ribose 1-diphosphate (PRPP) to UMP and diphosphate
Will allow negative selection, Will be Implementet in Modified Plasmid Backbones pSB2E, pSB4S, pSB1C to allow resistance free cloning

This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:

{|
|prefix with EcoRI, NotI, XbaI, SD and NgoMIV:
|GAATTCGCGGCCGCTTCTAGAG
|-
|suffix with AgeI, SpeI, NotI and PstI:
|ACCGGTTAATACTAGTAGCGGCCGCCTGCAG
|}
Sites of restriction enzymes generating compatible overhangs have the same color:

EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.

Notes

Mutation of Freiburg Standard Restriction Sites within the genomic uppcas was needed
Point Mutation of AgeI restriction site by change of G -> C at position 174
Point Mutation of EcoRI restriction site by change of C -> G at position 477

Source

Derived from pUC19_upp, AG Mascher
Originally from Bacillus subtilis 168 genomic DNA

Sequence Annotations

Sequence Annotation	Location	Component / Role(s)
uppcas	1,826	feature/misc, sequence_feature
upp	100,729	CDS, feature/cds

Other Properties

• igem#experience: None
• igem#sampleStatus: It's complicated
• igem#status: Planning
• synbiohub#ownedBy: user/james
• synbiohub#ownedBy: user/myers
• synbiohub#topLevel: BBa_K1351023/1

Member of these Collections

• iGEM Parts Registry