Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Cyprien Maisonnier
Date created: 2008-08-11 11:00:00
Date modified: 2015-05-08 01:10:02
Promoter of flhDC gene from E. coli flagella
| Types | DnaRegion |
| Roles | Regulatory promoter |
| Sequences | BBa_K136004_sequence (Version 1) |
Description
flhDC is the only class 1 gene that is part of the construction of the flagella. It is the master regulator of the biosynthesis of the flagella ( Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon ).The promoter of flhDC is regulated by many transcription factors, for instance, OmpR* and EnvZ* are two repressors of this gene.
Work in progress : Characterization of the repression by OmpR* and EnvZ*
Notes
The PCR on colony to amplify the promoter of flhDC did not work. We amplified both the promoter and the gene and then we did a specific amplification of the promoter from the full operon. We had a PCR amplicon of the right length this time.The primers used to amplify the promoter and the gene are :
* Forward :
GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTTGTATGTGCGTGTAGTGACGAGTACAG
* Reverse :
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTAAACAGCCTGTACTCTCTGTTCATCC
Then to amplify only the promoter we used :
* Forward :
GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTTGTATGTGCGTGTAGTGACGAGTACAG
* Reverse :
GTTTCTTCCTGCAGCGGCCGCTACTAGTATCCCACCCAGAATAACCAACTTTAT
Source
This part comes from the genome of E.coli K12 strain MG1655.| Sequence Annotation | Location | Component / Role(s) |
| Transcription start base OmpR binding site | 36,36 43,63 | start_codon feature/start non_covalent_binding_site feature/binding |