Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Cyprien Maisonnier
Date created: 2008-08-11 11:00:00
Date modified: 2015-05-08 01:10:02
Promoter of fliL gene from E. coli flagella
| Types | DnaRegion |
| Roles | promoter Regulatory |
| Sequences | BBa_K136000_sequence (Version 1) |
Description
fliL is a class 2 gene that is part of the construction of the flagella ( Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon, ).Its promoter is consitutively repressed.
It is activated by flhD4C2 and by fliA with different forces ( Using a Quantitative Blueprint to Reprogram the Dynamics of the Flagella Gene Network - Shiraz Kalir and Uri Alon ).
A deeper characterization is in project
Notes
The primers used to amplify this sequence are :Forward :
TCGAATTCGCGGCCGCTTCTAGAGCAAGGGCGTGTAACAGGCAAC
Reverse :
TCCTGCAGCGGCCGCTACTAGTAGTCATGTGTTGCGGTCTTCCTGTG
Source
This part comes from the genome of E.coli K12 strain MG1655.| Sequence Annotation | Location | Component / Role(s) |
| FlhDC binding site 1 FlhDC binding site 2 Initiation start for transcription 1 Initiation start for transcription 2 | 44,59 70,85 116,116 127,127 | feature/binding non_covalent_binding_site feature/binding non_covalent_binding_site sequence_feature feature/misc sequence_feature feature/misc |